Biology :: Intro to Bioinformatics :: How to find Vibrio Cholerae's Origin of Replication using Python

Taxonomy ::
Kingdom: Bacteria Phylum: Proteobacteria Class:Gammaproteobacteria Order: Vibrionales Family: Vibrionaceae Genus: Vibrio Species: cholerae

---

---

---

Bioinformatics is an interdisciplinary field mainly involving molecular biology and genetics, computer science, mathematics, and statistics. Data intensive, large-scale biological problems are addressed from a computational point of view. The most common problems are modeling biological processes at the molecular level and making inferences from collected data.

An origin of replication is a sequence of DNA at which replication is initiated on a chromosome, plasmid or virus. For small DNAs, including bacterial plasmids and small viruses, a single origin is sufficient. 

Larger DNAs have many origins, and DNA replication is initiated at all of them; otherwise, if all replication had to proceed from a single origin, it would take too long to replicate the entire DNA mass.

Vibrio Cholerae's Origin of Replication (ori):

" ATCAATGATCAACGTAAGCTTCTAAGCATGATCAAGGTGCTCACACAGTTTATCCACAACCTGAGTGGATGACATCAAGATAGGTCGTTGTATCTCCTTCCTCTCGTACTCTCATGACCACGGA
AAGATGATCAAGAGAGGATGATTTCTTGGCCATATCGCAATGAATACTTGTGACTTGTGCTTCCAATTGACATCTTCAGCGCCTATTGCGCTGGCCAAGGTGACGGAGCGGGATTACGAAAGCA
TGATCATGGCTGTTGTTCTGTTTATCTTGTTTTGACTGAGACTTGTTAGGATAGACGGTTTTTCATCACTGACTAGCCAAAGCCTTACTCTGCCTGACATCGACCGTAAATTGATAATGAATTTACAT
GCTTCCGCGACGATTTACCTCTTGATCATCGATCCGATTGAAGATCTTCAATTGTTAATTCTCTTGCCTCGACTCATAGCCATGATGAGCTCTTGATCATGTTTCCTTAACCCTCTATTTTTTACGGAA
GAATGATCAAGCTGCTGCTCTTGATCATCGTTTC "

---