ASK THE CAT
  • Ask
  • FAQ
  • R Winter Series
    • Create & Manipulate Matrices
    • Data Cleaning, Data Frames & Lists
    • Tidyverse
    • Creating Graphs with ggplot
  • AP CS A
    • Java July Series >
      • :: Classes & OOPs
      • :: Interface
      • :: Inheritance
      • :: Intro To Arrays Java
      • :: Arrays Continued
    • :: CS-A or CS-P?
    • :: Control Structures
    • :: Recursion
    • :: While Do While Loops in Java
    • :: Interface in Java
    • :: ArrayLists
    • :: Java Naming Conventions
    • :: Logic Circuits
    • :: Getters and Setters
    • :: Binary & Hexadecimal
  • Summer 2020 Tutoring
    • :: REPRESENT IT!
    • Pre-Algebra Sessions >
      • :: Basic Division
      • :: Complex Division
      • :: Estimation Division
      • :: Division Practice Problems
    • Algebra II >
      • :: Cubic Equations
      • :: Complex Numbers
    • Chemistry >
      • Molarity Basics
    • C++ Sessions >
      • :: Introduction
      • :: Style v Syntax
      • :: Variables & Data Types
      • :: Intialize/Declare Variables
      • :: Types of Operators
      • :: Strings and Input - Output
      • :: How to Construct Arrays
  • AP Bio
    • :: Sketch Notes >
      • :: Part 1
      • :: Part 2
    • :: epigenetics
    • :: Chi-Squared Tests
    • :: Cancer
    • :: Hox Genes
    • :: Hardy-Weinberg Principle
    • :: Rule of Multiplication + Addition for Punnett Squares
    • :: CRISPR
    • :: Amino Acid
    • :: Peptide
    • :: Why study Peptides
    • :: Aquaporins
    • :: Gram Stains
    • :: Graph on Excel for Bio Lab
  • AP Chem
    • Organic Chemistry
    • I. Properties of Matter >
      • Neutralization
    • II. Periodic table >
      • Org of Periodic Table
      • :: Groups
    • III. Chemical bonding >
      • :: Mass to Mass conversion
      • :: Naming Acids
      • :: Cross Drop Charge
      • :: Predicting Products
      • :: Balance Equation Question
      • :: Learn to Balance Equation
      • :: VSEPR Simulation
    • IV. Molar Mass >
      • ::LR ER and excess reatant
      • :: Molecular/Formula Mass
      • :: Empirical Formula & Molar Mass
      • :: Percentages & Empirical Formula
      • :: Empirical formula
    • IV. Solutions and Solubility >
      • :: Types of Solutions with Solubility Curves
      • :: Solubility Curve
    • V. Easy Tricks and Tips >
      • :: Tip to Molecular Shapes
      • Memorizing Bond Angles and Polarity
      • :: Chemistry Formulas
      • :: Trick Polyatomic ions
    • VI. General AP Concepts >
      • :: Potential Energy Diagrams
      • :: Haber-Bosch
      • :: Le Chatelier
      • :: Pressure & Moles
      • ::Rydberg's Constant vs Unit of Energy
      • :: Equilibrium and RICE Tables
      • :: Kinetics
      • Galvanic Cells
    • :: Flash cards
    • :: VSEPR
  • AP Stats
    • Chi-Squared Tests
    • Solving Chi-Sqd Test Using Sheets
    • Applications of Statistics
    • Standardized Scores
    • Distributions Transformations
  • AP Calc
    • DI Method - Tabular Integration
    • Polar Curves: Tangent Line and Slope
    • Riemann Sums: Left and Right Approximations
    • :: Conic Sections Flash cards
    • :: Parent Functions Flash cards
    • Worked Out Problems >
      • :: Worked Out Problems I
      • :: Worked Out Problems II
      • :: Worked Out Problems III
      • :: Worked Out Problems IV
      • :: Worked Out Problems V
      • :: Worked Out Problems VI
      • :: Worked Out Problems VII
      • :: Worked Out Problems VIII
      • :: Worked Out Problems IX
      • :: Worked Out Problems X
      • :: Worked Out Problems XI
      • :: Worked Out Problems XII
      • :: Worked Out Problems XIII
    • Applying Trig Identities
    • L'Hopital's Rule
    • Differences Between Conic Sections
    • Graphing Conic Sections
    • :: Pre-Calc - Trig Identities
    • Tangent & Normal Lines
    • Indefinite integrals: U Sub
    • Calculus Derivatives >
      • Product Rule
      • Quotient Rule
      • Chain Rule
  • Arduino
    • Quick Look
    • Project #1: Blinking LED
    • Project #2: Button LED
    • Project #3: Flowing LED
    • Project #4: LCD Display
    • Project #5: Serial Monitor
  • AP Español
    • AP Español Salsa
  • App
    • AP Go Pow How?
    • AP Go Pow APP Page
  • Musings
    • :: Bayesian Example
    • :: Nash equilibria
    • :: Bayesian Nash Equilibrium
    • :: Backward induction
    • :: what is ISS
    • :: Rotational Matrices
    • :: Primary v Secondary Pollutants
    • :: Black Hole
    • :: Covid-19 Hackathon
    • :: Evolution of Immunizations
    • :: Predictions of Diseases
    • :: Book List
    • :: Patterncount
    • :: Binary Classification
    • :: Cybersecurity
    • :: What is CIA Triad
    • :: What is Networking
    • :: Self Similarity
    • :: Trig Identities
    • :: UIL Number S
    • :: Box Offensive Play
    • :: Why Card Trick Works
    • :: Easy Multiplication
  • AP CREDIT
  • About

Biology :: Intro to Bioinformatics :: How to find Vibrio Cholerae's Origin of Replication using Python

Taxonomy ::
Kingdom: Bacteria Phylum: Proteobacteria Class:Gammaproteobacteria Order: Vibrionales Family: Vibrionaceae Genus: Vibrio Species: cholerae



Bioinformatics is an interdisciplinary field mainly involving molecular biology and genetics, computer science, mathematics, and statistics. Data intensive, large-scale biological problems are addressed from a computational point of view. The most common problems are modeling biological processes at the molecular level and making inferences from collected data.

An origin of replication is a sequence of DNA at which replication is initiated on a chromosome, plasmid or virus. For small DNAs, including bacterial plasmids and small viruses, a single origin is sufficient. 

Larger DNAs have many origins, and DNA replication is initiated at all of them; otherwise, if all replication had to proceed from a single origin, it would take too long to replicate the entire DNA mass.


Vibrio Cholerae's Origin of Replication (ori):

" ATCAATGATCAACGTAAGCTTCTAAGCATGATCAAGGTGCTCACACAGTTTATCCACAACCTGAGTGGATGACATCAAGATAGGTCGTTGTATCTCCTTCCTCTCGTACTCTCATGACCACGGA
AAGATGATCAAGAGAGGATGATTTCTTGGCCATATCGCAATGAATACTTGTGACTTGTGCTTCCAATTGACATCTTCAGCGCCTATTGCGCTGGCCAAGGTGACGGAGCGGGATTACGAAAGCA
TGATCATGGCTGTTGTTCTGTTTATCTTGTTTTGACTGAGACTTGTTAGGATAGACGGTTTTTCATCACTGACTAGCCAAAGCCTTACTCTGCCTGACATCGACCGTAAATTGATAATGAATTTACAT
GCTTCCGCGACGATTTACCTCTTGATCATCGATCCGATTGAAGATCTTCAATTGTTAATTCTCTTGCCTCGACTCATAGCCATGATGAGCTCTTGATCATGTTTCCTTAACCCTCTATTTTTTACGGAA
GAATGATCAAGCTGCTGCTCTTGATCATCGTTTC
"


Picture

keentween

  • Ask
  • FAQ
  • R Winter Series
    • Create & Manipulate Matrices
    • Data Cleaning, Data Frames & Lists
    • Tidyverse
    • Creating Graphs with ggplot
  • AP CS A
    • Java July Series >
      • :: Classes & OOPs
      • :: Interface
      • :: Inheritance
      • :: Intro To Arrays Java
      • :: Arrays Continued
    • :: CS-A or CS-P?
    • :: Control Structures
    • :: Recursion
    • :: While Do While Loops in Java
    • :: Interface in Java
    • :: ArrayLists
    • :: Java Naming Conventions
    • :: Logic Circuits
    • :: Getters and Setters
    • :: Binary & Hexadecimal
  • Summer 2020 Tutoring
    • :: REPRESENT IT!
    • Pre-Algebra Sessions >
      • :: Basic Division
      • :: Complex Division
      • :: Estimation Division
      • :: Division Practice Problems
    • Algebra II >
      • :: Cubic Equations
      • :: Complex Numbers
    • Chemistry >
      • Molarity Basics
    • C++ Sessions >
      • :: Introduction
      • :: Style v Syntax
      • :: Variables & Data Types
      • :: Intialize/Declare Variables
      • :: Types of Operators
      • :: Strings and Input - Output
      • :: How to Construct Arrays
  • AP Bio
    • :: Sketch Notes >
      • :: Part 1
      • :: Part 2
    • :: epigenetics
    • :: Chi-Squared Tests
    • :: Cancer
    • :: Hox Genes
    • :: Hardy-Weinberg Principle
    • :: Rule of Multiplication + Addition for Punnett Squares
    • :: CRISPR
    • :: Amino Acid
    • :: Peptide
    • :: Why study Peptides
    • :: Aquaporins
    • :: Gram Stains
    • :: Graph on Excel for Bio Lab
  • AP Chem
    • Organic Chemistry
    • I. Properties of Matter >
      • Neutralization
    • II. Periodic table >
      • Org of Periodic Table
      • :: Groups
    • III. Chemical bonding >
      • :: Mass to Mass conversion
      • :: Naming Acids
      • :: Cross Drop Charge
      • :: Predicting Products
      • :: Balance Equation Question
      • :: Learn to Balance Equation
      • :: VSEPR Simulation
    • IV. Molar Mass >
      • ::LR ER and excess reatant
      • :: Molecular/Formula Mass
      • :: Empirical Formula & Molar Mass
      • :: Percentages & Empirical Formula
      • :: Empirical formula
    • IV. Solutions and Solubility >
      • :: Types of Solutions with Solubility Curves
      • :: Solubility Curve
    • V. Easy Tricks and Tips >
      • :: Tip to Molecular Shapes
      • Memorizing Bond Angles and Polarity
      • :: Chemistry Formulas
      • :: Trick Polyatomic ions
    • VI. General AP Concepts >
      • :: Potential Energy Diagrams
      • :: Haber-Bosch
      • :: Le Chatelier
      • :: Pressure & Moles
      • ::Rydberg's Constant vs Unit of Energy
      • :: Equilibrium and RICE Tables
      • :: Kinetics
      • Galvanic Cells
    • :: Flash cards
    • :: VSEPR
  • AP Stats
    • Chi-Squared Tests
    • Solving Chi-Sqd Test Using Sheets
    • Applications of Statistics
    • Standardized Scores
    • Distributions Transformations
  • AP Calc
    • DI Method - Tabular Integration
    • Polar Curves: Tangent Line and Slope
    • Riemann Sums: Left and Right Approximations
    • :: Conic Sections Flash cards
    • :: Parent Functions Flash cards
    • Worked Out Problems >
      • :: Worked Out Problems I
      • :: Worked Out Problems II
      • :: Worked Out Problems III
      • :: Worked Out Problems IV
      • :: Worked Out Problems V
      • :: Worked Out Problems VI
      • :: Worked Out Problems VII
      • :: Worked Out Problems VIII
      • :: Worked Out Problems IX
      • :: Worked Out Problems X
      • :: Worked Out Problems XI
      • :: Worked Out Problems XII
      • :: Worked Out Problems XIII
    • Applying Trig Identities
    • L'Hopital's Rule
    • Differences Between Conic Sections
    • Graphing Conic Sections
    • :: Pre-Calc - Trig Identities
    • Tangent & Normal Lines
    • Indefinite integrals: U Sub
    • Calculus Derivatives >
      • Product Rule
      • Quotient Rule
      • Chain Rule
  • Arduino
    • Quick Look
    • Project #1: Blinking LED
    • Project #2: Button LED
    • Project #3: Flowing LED
    • Project #4: LCD Display
    • Project #5: Serial Monitor
  • AP Español
    • AP Español Salsa
  • App
    • AP Go Pow How?
    • AP Go Pow APP Page
  • Musings
    • :: Bayesian Example
    • :: Nash equilibria
    • :: Bayesian Nash Equilibrium
    • :: Backward induction
    • :: what is ISS
    • :: Rotational Matrices
    • :: Primary v Secondary Pollutants
    • :: Black Hole
    • :: Covid-19 Hackathon
    • :: Evolution of Immunizations
    • :: Predictions of Diseases
    • :: Book List
    • :: Patterncount
    • :: Binary Classification
    • :: Cybersecurity
    • :: What is CIA Triad
    • :: What is Networking
    • :: Self Similarity
    • :: Trig Identities
    • :: UIL Number S
    • :: Box Offensive Play
    • :: Why Card Trick Works
    • :: Easy Multiplication
  • AP CREDIT
  • About